اثر انتخاب مصنوعی بر روی ساختار ژنتیکی جمعیت‌های راش (Fagus orientalis Lipsky)

نوع مقاله: مقاله علمی - پژوهشی

نویسندگان

چکیده

در این پژوهش اثر انتخاب مصنوعی به‌عنوان یکی از مهمترین عملیات در مدیریت جنگل که در طی تنک‌‌کردن و انتخاب درختان بذرگیری اعمال می‌شود بر روی ساختار ژنتیکی راش (Fagus orientalis Lipsky)  بررسی گردید. در ده جمعیت راش در طول گستره جنگل‌های خزری، ژنوتیپ درختان جمعیت با ده درخت مادری و بذرهایشان (هفت بذر به ازاء هر درخت) به‌عنوان نسل بعدی براساس لوکوس‌‌های میکروساتلایتی پلی‌مورف مقایسه گردید. در 2 جمعیت نیز بذرها و جوانه‌های درختان بدفرم و خوش‌فرم برای مطالعه اثر انتخاب درختان با در نظر گرفتن ویژگی‌های فنوتیپی در مدیریت جنگل، بررسی شدند. تفاوت‌‌های معنی‌داری در غنای آللی یا تعداد آلل‌های مشاهده شده (Na)، تعداد آلل‌‌های مؤثر (Ne)، تعداد آلل‌‌های نادر، هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) بین درختان و نمونه‌های بذری هر جمعیت مشاهده شد. به علت ارتباط بین وجود آلل‌‌های نادر و فنوتیپ درخت، حذف درختان با در نظر گرفتن ویژگی‌‌های فنوتیپی‌شان باعث کاهش تعداد آلل‌‌های نادر و تغییر فراوانی آللی می‌شود که منجر به کاهش توانمندی ژنتیکی آینده می‌گردد. به علت مزیت تکاملی بلندمدت اشکال ژنی نادر، فقدان آلل‌‌های نادر می‌تواند منجر به کاهش توانمندی جمعیت‌‌ها برای سازگاری و نیز کاهش قدرت بقاء در برابر تغییرات محیطی شود. این تغییرات نشان می‌دهد که انتخاب یا تنک‌کردن شدید ممکن است اثر زیادی بر ساختار ژنتیکی جمعیت‌‌های راش در بلندمدت بگذارد. در حالی که بنظر می‌رسد جمعیت‌‌های راش تحت تأثیر فعالیت‌‌های تنک‌‌کردن جزئی قرار نمی‌گیرند، بنابراین سیستم‌‌های انتخابی (تک‌گزینی و گروه‌گزینی) سیستم‌‌های جنگل‌شناسی مناسبی برای جنگل‌‌های راش خزری هستند. این مسئله حاکی از کارایی سیاست‌‌های مدیریت پایدار جمعیت با تأکید بر سیستم جنگل‌شناسی نزدیک به طبیعت و کاربرد روش‌‌های جنگل‌شناسی آمیخته است. 

کلیدواژه‌ها


دو فصلنامة علمی-پژوهشی تحقیقات ژنتیک واصلاح گیاهان مرتعی و جنگلی ایران

جلد 18، شمارة 2، صفحة 180-165 (1389)

 

اثر انتخاب مصنوعی بر روی ساختار ژنتیکی جمعیت‌های راش

(Fagus orientalis Lipsky)

 

پروین صالحی شانجانی*1، جوزپه جوانی وندرامین2 و محسن کلاگری3

1*- نویسنده مسئول مکاتبات، استادیار، مؤسسه تحقیقات جنگلها و مراتع کشور، تهران

2- استاد، انستیتو ژنتیک گیاهی فلورنس، ایتالیا

3- استادیار، مؤسسه تحقیقات جنگلها و مراتع کشور، تهران

 

تاریخ دریافت: 08/04/88              تاریخ پذیرش: 23/03/89

 

چکیده

در این پژوهش اثر انتخاب مصنوعی به‌عنوان یکی از مهمترین عملیات در مدیریت جنگل که در طی تنک‌‌کردن و انتخاب درختان بذرگیری اعمال می‌شود بر روی ساختار ژنتیکی راش (Fagus orientalis Lipsky)  بررسی گردید. در ده جمعیت راش در طول گستره جنگل‌های خزری، ژنوتیپ درختان جمعیت با ده درخت مادری و بذرهایشان (هفت بذر به ازاء هر درخت) به‌عنوان نسل بعدی براساس لوکوس‌‌های میکروساتلایتی پلی‌مورف مقایسه گردید. در 2 جمعیت نیز بذرها و جوانه‌های درختان بدفرم و خوش‌فرم برای مطالعه اثر انتخاب درختان با در نظر گرفتن ویژگی‌های فنوتیپی در مدیریت جنگل، بررسی شدند. تفاوت‌‌های معنی‌داری در غنای آللی یا تعداد آلل‌های مشاهده شده (Na)، تعداد آلل‌‌های مؤثر (Ne)، تعداد آلل‌‌های نادر، هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) بین درختان و نمونه‌های بذری هر جمعیت مشاهده شد. به علت ارتباط بین وجود آلل‌‌های نادر و فنوتیپ درخت، حذف درختان با در نظر گرفتن ویژگی‌‌های فنوتیپی‌شان باعث کاهش تعداد آلل‌‌های نادر و تغییر فراوانی آللی می‌شود که منجر به کاهش توانمندی ژنتیکی آینده می‌گردد. به علت مزیت تکاملی بلندمدت اشکال ژنی نادر، فقدان آلل‌‌های نادر می‌تواند منجر به کاهش توانمندی جمعیت‌‌ها برای سازگاری و نیز کاهش قدرت بقاء در برابر تغییرات محیطی شود. این تغییرات نشان می‌دهد که انتخاب یا تنک‌کردن شدید ممکن است اثر زیادی بر ساختار ژنتیکی جمعیت‌‌های راش در بلندمدت بگذارد. در حالی که بنظر می‌رسد جمعیت‌‌های راش تحت تأثیر فعالیت‌‌های تنک‌‌کردن جزئی قرار نمی‌گیرند، بنابراین سیستم‌‌های انتخابی (تک‌گزینی و گروه‌گزینی) سیستم‌‌های جنگل‌شناسی مناسبی برای جنگل‌‌های راش خزری هستند. این مسئله حاکی از کارایی سیاست‌‌های مدیریت پایدار جمعیت با تأکید بر سیستم جنگل‌شناسی نزدیک به طبیعت و کاربرد روش‌‌های جنگل‌شناسی آمیخته است.

 

واژه‌های کلیدی: Fagus orientalis Lipsky، انتخاب مصنوعی، میکروساتلایت، تمایز ژنتیکی.

 

 

 


مقدمه

انسان از زمانی که اکوسیستم‌‌های جنگلی را مورد بهره‌برداری قرار داد بصورت عمدی یا غیرعمدی ذخیره ژنی گونه‌های درختان جنگلی را تغییر داده است. در این میان تنها اکوسیستم‌‌هایی که تنوع ژنتیکی پویایی دارند باقی خواهند ماند. بنابراین در مدیریت جنگل باید جنبه‌های ژنتیکی نیز در نظر گرفته شود تا استمرار بقاء و توانمندی تکاملی جمعیت‌‌های درختان حفظ شود
(Booy et al., 2000؛Boyle, 2000 ). مدیریت جنگل‌‌ها به شیوه‌های مختلفی همچون فرایندهای وابسته به رانش ژنتیکی (Drift) (مثل تعداد محدود دختان بذر دهنده)، فرایندهای وابسته به سیستم تولیدمثلی (مثل جدایی تولیدمثلی)، فرایندهای وابسته به انتخاب (مثل انتخاب درختان نخبه) و فرایندهای وابسته به مهاجرت (مثل انتقال مواد تولیدمثلی جنگل)، منابع ژنتیکی را متأثر می‌نمایند (Buiteveld et al., 2007).

امروزه اثر مدیریت جنگلها بر روی ساختار ژنتیکی درختان جنگلی مورد توجه بسیاری به‌ویژه در بازدانگان(El-Kassaby et al., 2003؛ MacDonald et al., 2001)، برخی گونه‌های گرمسیری (Lee و همکاران، 2002) و جنس اکالیپتوس (Glaubitz et al., 2003a, b) قرار گرفته است. در این رابطه نتایج ضد ونقیضی برای گونه‌های مختلف گزارش شده است. تنوع ژنتیکی در جمعیت‌های جنگل‌کاری شده Picea glauca (Rajora, 1999) و بهره‌برداری شده Swietenia macrophylla (Gilles et al., 1999) کاهش یافته است. تنوع ژنتیکی Tsuga heterophyllaدر جمعیت‌های مدیریت شده تحت شیوه پناهی کمتر از جمعیت‌های طبیعی است
(El-Kassaby et al., 2003). از سوی دیگر اختلاف معنی‌داری در پارامترهای تنوع ژنتیکی بین جمعیت‌های مدیریت شده با شیوه پناهی و طبیعی
Abies amabilis(El-Kassaby et al., 2003) و Douglas-fir (El-Kassaby & Benowicz, 2000) مشاهده نشد. در حالی که مطالعات بسیاری نشان داده‌اند که مدیریت جنگل می‌تواند منجر به از دست رفتن آلل‌‌های نادر و مختص به محل شود (به‌عنوان مثال، در اثر بهره‌برداری در کاج سفید شرقی، Rajora et al., 2000؛ در اثر مدیریت با شیوه پناهی در Douglas-fir، Adams et al., 1998). نتایج فوق این فرضیه را قوت می‌بخشد که تغییر ژنتیکی حاصل مدیریت جنگل وابسته به نوع گونه و نیز شرایط محیطی محلی است.

جنگل‌های آمیخته و خالص راش (Fagus orientalis Lipsky) به‌عنوان یک گونه دگرگشن جزء مهمترین، غنی‌ترین و زیباترین جنگل‌های ایران به‌شمار می‌روند. جنگل‌های راش 6/17% از سطح جنگل‌های هیرکانی و 6/23% تعداد و حدود 30% از حجم درختان جنگلی ناحیه هیرکانی را تشکیل می‌دهند (رسانه و همکاران، 1380). بنابراین از نظر اقتصادی جمعیت‌های راش باارزشترین جمعیت‌ها را تشکیل داده و بیشترین میزان تولید چوب در ایران را به خود اختصاص می‌دهند. جنگل‌‌های شمال ایران (خزری)، با تنوع منحصربفرد درختان، درختچه‌ها و گیاهان علفی یکی از مهمترین اکوسیستم‌‌های جنگلی کشور می‌‌باشند.

یکی از مهمترین اهداف شیوه جنگلداری که جنگل‌‌های ایران از 40 سال قبل با آن مدیریت شده‌اند، استفاده از توانمندی اقتصادی جنگل‌‌ها بود. براساس این هدف، مجریان پرورش جنگل یا نشانه‌گذارها با انتخاب درختان خوش‌فرم سعی در اصلاح جمعیت‌ها نمودند. زیرا پیدایش چنگال بر روی تنه باعث کاهش چشمگیر طول محور اصلی (تنه درخت) شده و به این ترتیب ارزش تجاری درخت بطور قابل ملاحظه‌ای کاهش می‌یابد (Ningre, 1987).

تنوع و ساختار ژنتیکی راش در جنگل‌‌های خزری بوسیله مارکرهای آنزیمی و میکروساتلایتی بررسی شده است (Salehi Shanjani et al., 2002, 2004, 2005, 2008). راش مثل بسیاری از گونه‌های درختی دارای سطوح بالایی از تنوع در لوکوس‌‌های ایزوآنزیمی و DNA هسته‌ای بوده (Hamrick et al., 1992) ولی دارای تمایز جمعیتی ناچیزیست. براساس داده‌های DNA کلروپلاستی الگوی تمایز مکانی در بین جمعیت‌‌های راش بسیار مشخص است (Salehi Shanjani et al., 2004). با این حال هیچ پژوهشی بر روی اثر مدیریت جنگل، بر ساختار ژنتیکی راش ایران گزارش نشده است.

یکی از مؤلفه‌های مهم در مدیریت جنگل انتخاب درختان است. انتخاب ممکن است با در نظر گرفتن ویژگی‌‌های فنوتیپی درخت برای اصلاح جمعیت‌ها و حذف درختان بدفرم باشد و یا براساس سایر ویژگی‌‌های درخت مانند تولید بالای بذر باشد. هدف از مطالعه حاضر بررسی اثر انتخاب در فرایندهای مدیریت جنگل بر تنوع ژنتیکی جمعیت‌‌های راش است.

 

مواد و روشها

در طول گستره پراکنش راش در ایران 10 جمعیت انتخاب گردید که عبارتند از: گرگان-·1400، گرگان-600، نکا-1400، نکا-900، سنگده-1400، سنگده-900، خیرودکنار-1200، خیرودکنار-600، اسالم-1200 و اسالم-600. در هر جمعیت 1) جوانه‌های درختان جمعیت، 2) جوانه‌های 10 درخت مادری و 3) بذرهای همان درختان مادری؛ از هر درخت 7نیز بذر به‌عنوان نسل نتاج جمع‌آوری گردید. ژنوتیپ کلیه نمونه‌ها با استفاده از میکروساتلایت‌‌های هسته‌ای تعیین گردید. در دو جمعیت گرگان-600 و خیرودکنار-1200 نیز بذرها و درختان بدفرم (چنگالی) و خوش‌فرم (میانرو) برای مطالعه اثر انتخاب درختان با در نظر گرفتن ویژگی‌‌های فنوتیپی در مدیریت جنگل، بررسی شدند.

DNA کل از بذرها و جوانه‌های خواب درختان (100 میلی‌گرم به‌عنوان ماده اولیه) با استفاده از کیت (Germany, Macherey Negel) Nucleospin plant جداسازی شد. عصاره‌ها ( یک میکرولیتر به ازای هر چاهک) به وسیله دستگاه الکتروفورز روی ژل آگارز 1% (W/V) با نیروی برق 10 ولت در سانتیمتر به مدت یک ساعت و بافر (x50)TEA  حاوی 5/0 میلی‌گرم بر میلی‌لیتر(W/V) اتیدیوم‌برماید کنترل شده و ژل‌ها پس از عکس‌برداری با یک اسکنر UVP تجزیه شدند. میکروساتلایت‌‌های FS1-15، FS1-03, FS1-11 و
FS3-04 (جدول 1) ارائه شده توسطPastorelli  و همکاران (2003) از طریق PCR تکثیر شدند. برای تکثیر با PCR محیط فرایند (Tris-HCl با 9=pH، mM 100؛KCL، 500 mM؛ MgCl2، mM 15؛ از هر داکسی‌نوکلئوزیدتری فسفات 200µM؛ از هر پرایمر µM4/0 و Taq DNA polymeras  (یک واحد) با حجم نهایی ml 25 تهیه گردید. پس از نگهداری محلول واکنش به مدت 5 دقیقه در ºC 95، محلول واکنش در معرض چرخه‌های دمایی 30 چرخه: ºC 95 به مدت یک دقیقه، دمای اتصال (جدول شماره 1 ) به مدت یک دقیقه، ºC 72 به مدت 1 دقیقه قرار گرفتند. سپس فرآورده‌های تکثیر در ºC 72 به مدت 8 دقیقه نگهداری شدند. در این کار از دستگاه PCR ساخت شرکت Perkin Elmer 9700 استفاده شد. طول قطعات تکثیر شده توسط توالی‌یاب خودکار(Alf Express, Pharmacia) اندازه‌گیری گردید و نتیجه توسط برنامه نرم‌افزاری (Fragment Manager 1.2 Pharmacia) بررسی شد.

 

تجزیه و تحلیل آماری

پس از اینکه برای هر فرد، ژنوتیپ‌های دیپلوئید شماره‌گذاری و فراوانی‌های آللی محاسبه شد، مطالعه تمایز ژنتیکی درختان خوش‌فرم و بدفرم راش توسط نرم‌افزار GenALEx 6 (Peakal & Smouse, 2006) با معیارهایی همچون میانگین تعداد آلل بر لوکوس (Na)، تعداد آلل‌‌های نادر، تعداد آلل‌‌های مؤثر (Ne)، هتروزیگوسیتی مشاهده شده (Ho)، هتروزیگوسیتی مورد انتظار از معادله هاردی-وینبرگ (He)، ضریب خویش‌آمیزی یا اندیس تثبیت (Fis). انجام شد. انحراف فراوانی‌‌های ژنوتیپی از نسبت‌‌های هاردی-وینبرگ با برنامه نرم‌افزاری GENEPOP (نسخه 3.4D; Raymond & Rousset, 1995) بدست آمد. فاصله ژنتیکی میان جمعیت‌‌ها براساس معادله Nei (1978) برآورد شد. از روش تجزیه به مؤلفه‌های اصلی PCA (Gower، 1966) برای تفسیر ماتریکس فاصله ژنتیکی استفاده شد. ساختار ژنتیکی جمعیتی کل نمونه‌‌ها با آماره F توسط نرم‌افزار ARLEQUIN (Schnieder et al., 1997, 2000) محاسبه شد. ضریب خویش‌آمیزی کلی (Fit)، و نسبت واریانس ژنتیکی از طریق گوناگونی در میان کل جمعیت‌‌ها (Fst)، گوناگونی در میان جمعیت‌‌های هر منطقه و گوناگونی میان مناطق محاسبه شد.ژ

 

 

 

جدول 1- ویژگی‌‌های 4 مارکر میکروساتلایت هسته‌ای Pastorelli) و همکاران 2003) بکار رفته

برای مطالعه تمایز درختان بدفرم و خوش‌فرم راش

لوکوس

توالی پرایمر 

5'-3'

دمای اتصال °C))

غلظت MgCl2

(mM)

تکرار

اندازه آلل‌‌های مشاهده شده

تعداد آلل‌‌ها

Gene Bank Accession no.

FS1-15

TCAAACCCAGTAAATTTCTCA

60

25

(GA)26

83-133

12

AF528095

 

GCCTCAATGAACTCAAAAAC

 

 

 

 

 

 

FS1-03

CACAGCTTGACACATTCCAAC

60

15

(GA)18

86-112

12

AF528090

 

TGGTAAAGCACTTTTTCCCACT

 

 

 

 

 

 

FS1-11

TGAATTCAATCATTTGACCATTC

63

25

(GA)15

98-120

9

AF528091

 

GGAAGGGTGCTTCAATTTGG

 

 

 

 

 

 

FS3-04

AGATGCACCACTTCAAATTC

60

15

(GCT)5(GTT)3(GCT)6

192-204

4

AF528092

 

TCTCCTCAGCAACATACCTC

 

 

 

 

 

 

 

 


نتایج

بررسی اثر انتخاب بدون در نظر گرفتن ویژگی‌‌های فنوتیپی

در 10 جمعیت در گستره جنگل‌‌های راش خزری مقایسه‌ای براساس 4 میکروساتلایت هسته‌ای (F1-03، F1-11، F3-04 و FS1-15) بین درختان جمعیت، 10 درخت مادری منتخب و بذرهای درختان مادری فوق انجام شد. تمام 4 لوکوس میکروساتلایت مورد بررسی پلی‌مورفیسم بالایی نشان دادند. 

مقایسه میانگین تعداد آلل در لوکوس، تعداد آلل‌‌های مؤثر، برآوردهای تنوع ژنتیکی (He) و شاخص تثبیت (Fis) درختان جمعیت، 10 درخت مادری منتخب و بذرهای درختان مادری فوق در میان جمعیت‌ها در جدول 2 نشان داده شده است. میانگین تعداد آلل در لوکوس ده درخت مادری منتخب کمتر از درختان جمعیت بود. این ضریب در بذرهای بیشتر جمعیت‌ها بیشتر از درختان جمعیت بود. به همین ترتیب تعداد آلل‌های مؤثر در درختان مادر کمتر از درختان جمعیت بود، درحالی که برخلاف تعداد آلل در لوکوس، تعداد آلل‌‌های مؤثر درختان جمعیت در بیشتر جمعیت‌‌ها بیش از مقادیر آن در بذرها بود. مطالعه آلل‌‌های مشاهده شده در نمونه‌های درختی و بذری کلیه جمعیت‌‌ها نشان داد که تعداد آلل‌‌های نادر که عموماً فراوانی کمی نیز دارند در هر دو درختان مادری و بذرها کاهش یافته است (جدول 3). وجود برخی آلل‌‌های نادر که در بذرها وجود دارند ولی در درختان جمعیت مشاهده نمی‌شوند نشان‌دهنده جریان ژن از جمعیت‌های مجاور است.

میزان هر دو هتروزیگوسیتی مشاهده شده و مورد انتظار در نمونه‌‌های درختان جمعیت بیشتر از بذرها است (جدول 2). بعلاوه در بیشتر جمعیت‌‌های مورد مطالعه میزان هتروزیگوسیتی مشاهده شده درختان جمعیت بیش از هتروزیگوسیتی مورد انتظار است که این موضوع نشان‌دهنده وجود کمبود هموزیگوت‌‌ها در جمعیت‌‌هاست. این ویژگی را اگر در بذرها بررسی نماییم متوجه تغییر این وضعیت در بذرها می‌‌شویم؛ بطوریکه در بسیاری از جمعیت‌‌ها تعداد هموزیگوت‌‌ها افزایش یافته است. میانگین هتروزیگوسیتی مورد انتظار در درختان جمعیت، درختان مادر و بذرها به‌ترتیب 567/0، 477/0 و 544/0 بود و میانگین هتروزیگوسیتی مشاهده شده به‌ترتیب 579/0، 565/0 و 550/0 بود. همانگونه که مقایسه میانگین این دو هتروزیگوسیتی نشان می‌‌دهد به‌‌رغم تعداد بیشتر میانگین آلل در لوکوس در بذرها، تنوع ژنتیکی بذرها کمتر از درختان جمعیت است. اندیس تثبیت (Fis) انحراف از توزیع تصادفی ژنوتیپی را اندازه‌گیری می‌‌کند و ارتباط بین آلل‌‌های مشابه را درون افراد و جمعیت‌‌ها نشان می‌‌دهد. به عبارت دیگر مقیاسی برای مطالعه میزان خویش‌آمیزی (inbreeding) است. مقادیر اندیس ثبوت در 4 لوکوس در سطح جمعیت‌‌ها نشان دادند که از 10 جمعیت مورد مطالعه، میانگین Fis درختان جمعیت در هشت جمعیت منفی بود که نشان‌دهنده کمبود هموزیگوت‌‌ها در جمعیت‌‌های فوق است (جدول 2). این ضریب در درختان مادری منتخب منفی‌تر از درختان جمعیت بود. شاخص تثبیت بذرها 50% جمعیت‌‌ها مثبت بود که حاکی از نقص هتروزیگوسیتی در بذرها آن جمعیت‌‌ها می‌باشد.

فرمول آماری F اغلب برای مطالعه پلی‌مورفیسم ژنی در جمعیت‌‌ها استفاده می‌‌شود و برآوردهای آن مقیاس مناسبی برای شناخت اثرات انتخاب و سیستم تولیدمثلی می‌باشد. جدول شماره 4 مقادیر فرمول آماری F را در 4 لوکوس نمونه‌‌های درختان جمعیت، درختان مادری منتخب و بذرها مقایسه می‌‌نماید. همانگونه که مشاهده می‌‌شود هیچ برآوردی صفر نشد. برآورد Fst به‌عنوان مقیاس تمایز ژنتیکی در بیشتر لوکوس‌‌های مورد مطالعه نشان دادند که نمونه‌‌های بذرها دارای تمایز ژنتیکی کمتری از درختان مادری است.

برای تشریح الگوی تمایز، فاصله ژنتیکی بین جمعیت‌‌ها براساس برآورد نااریب فاصله ژنتیکی Nei در نمونه‌‌های درختان جمعیت‌، درختان مادری منتخب و بذرها جمعیت‌‌های مختلف مطالعه شد. از فاصله ژنتیکی بین جمعیت‌‌ها برای تجزیه به مؤلفه‌های اصلی (PCA) استفاده شد. نمودارهای تشکیل شده نشان داد که تمایز ژنتیکی با فاصله جغرافیایی منطبق نیستند (شکل 1). با توجه به اینکه در نمونه‌‌های درختان جمعیت‌، درختان مادری منتخب و بذرهای جمعیت‌‌های مختلف به‌ترتیب حدود 89، 85 و 87% گوناگونی در میان سه مؤلفه اصلی قرار دارد، بنابراین این سه مؤلفه به‌عنوان مؤلفه‌های اصلی در نظر گرفته ‌شدند. همانگونه که در شکل مشاهده می‌شود اولین مؤلفه جمعیت‌های منطقه اسالم و خیرودکنار-1200 را از سایر جمعیت‌‌ها جدا کرده است. ولی رسته‌بندی سایر جمعیت‌ها در نمودارهای مختلف متفاوت است.

 

بررسی اثر انتخاب بدون در نظر گرفتن ویژگی فرم درخت

در این قسمت در دو جمعیت گرگان-600 و خیرودکنار-1200 بذرها و درختان جمعیت از لحاظ فرم درخت به دو گروه خوش‌فرم و بدفرم تقسیم شده و با هم مقایسه شدند. شکل 2-5 مقایسه تعداد، اندازه  و فراوانی آلل‌‌های 4 لوکوس مورد بررسی را در بذرها و درختان گروه‌‌های بدفرم و خوش‌فرم دو جمعیت مورد ذکر را نشان می‌دهد. همانگونه که در شکل‌ها مشاهده می‌شود در کلیه لوکوس‌‌ها اندازه، تعداد و فراوانی آلل‌‌ها در گروه‌‌های بدفرم و خوش‌فرم درختان تغییر کرده است. تغییر در این ضرایب تأثیر بسزایی در میزان تنوع ژنتیکی و سایر پارامترهای ژنتیکی می‌گذارد.

 

‌‌‌‌‌‌‌‌‌‌


جدول 2- برخی ویژگی‌‌های ژنتیکی درختان جمعیت، درختان مادری منتخب و بذرهای جمعیت‌‌های مختلف، براساس لوکوس‌‌های میکروساتلایت هسته‌ای

جمعیت

 

گرگان

گرگان

نکا

نکا

سنگده

سنگده

خیرودکنار

خیرودکنار

اسالم

اسالم

ارتفاع

 

1400

600

1400

900

1400

900

1200

600

1200

600

کد جمعیت

 

گ-1400

G-1400

گ-600

G-600

ن-1400

N-1400

ن-900

N-900

س-1400

S-1400

س-900

S-900

خ-1200

K-1200

خ-600

K-600

الف-1200

A-1200

الف-600

A-600

تعداد آلل در لوکوس

درختان جمعیت

6

8

25/8

25/7

7

25/10

75/7

5/8

8

5/7

 

درختان مادری

5/3

5/4

75/4

4/0

25/4

5/4

75/3

25/4

25/4

5/4

 

بذرها

5/6

5/8

25/8

75/7

5/9

8

5/8

75/9

25/9

75/7

 

 

 

 

 

 

 

 

 

 

 

 

تعداد آلل‌‌های مؤثر

درختان جمعیت

89/1

89/2

75/2

90/2

40/2

63/3

73/3

68/2

28/2

53/2

 

درختان مادری

58/1

26/2

78/2

50/2

68/1

43/2

45/2

53/2

88/1

39/2

 

بذرها

14/2

88/2

68/2

68/2

22/2

78/2

98/2

71/2

01/2

68/2

 

 

 

 

 

 

 

 

 

 

 

 

هتروزیگوسیتی مورد انتظار

درختان جمعیت

460/0

604/0

582/0

583/0

547/0

618/0

624/0

581/0

528/0

543/0

 

درختان مادری

311/0

531/0

526/0

528/0

38/0

509/0

534/0

506/0

420/0

523/0

 

بذرها

45/0

59/0

55/0

57/0

50/0

56/0

59/0

59/0

48/0

55/0

 

 

 

 

 

 

 

 

 

 

 

 

هتروزیگوسیتی مشاهده شده

درختان جمعیت

532/0

657/0

663/0

576/0

573/0

553/0

655/0

531/0

582/0

471/0

 

درختان مادری

375/0

688/0

700/0

650/0

467/0

600/0

575/0

625/0

475/0

500/0

 

بذرها

461/0

564/0

568/0

545/0

529/0

563/0

570/0

647/0

507/0

545/0

 

 

 

 

 

 

 

 

 

 

 

 

شاخص تثبیت

درختان جمعیت

16/0-

1/0-

14/0-

03/0-

06/0-

12/0

06/0-

09/0

12/0-

09/0

 

درختان مادری

17/0-

28/0-

31/0-

22/0-

20/0-

16/0-

09/0-

22/0-

12/0-

04/0

 

بذرها

43/0-

31/0

06/0-

01/0

05/0-

01/0

03/0

11/0-

04/0-

01/0


جدول 3- آلل‌‌های مشاهده شده (براساس اندازه جفت باز) 4 لوکوس مورد مطالعه درختان جمعیت، درختان مادری منتخب و بذرهای آنها در کل جمعیت‌‌های مورد مطالعه

کد پرایمر

درختان جمعیت

درختان مادری

بذرها

 

کد پرایمر

درختان جمعیت

درختان مادری

بذرها

 

کد پرایمر

درختان جمعیت

درختان مادری

بذرها

 

کد پرایمر

درختان جمعیت

درختان مادری

بذرها

 

FS1-15

 

69

-

-

 

 

FS3-04

 

192

-

 

192

 

 

FS1-11

 

92

-

-

 

 

FS1-03

 

68

-

-

 

81

-

81

 

 

195

195

195

 

 

94

94

94

 

 

80

80

80

 

83

83

83

 

 

198

198

198

 

 

96

96

96

 

 

84

84

84

 

85

85

85

 

 

201

201

201

 

 

98

98

98

 

 

86

86

86

 

87

87

87

 

 

204

204

204

 

 

100

100

100

 

 

88

88

88

 

89

-

89

 

 

207

207

207

 

 

102

102

102

 

 

90

90

90

 

91

91

91

 

 

 

 

 

 

 

104

-

104

 

 

92

92

92

 

93

93

93

 

 

 

 

 

 

 

106

-

106

 

 

94

94

94

 

95

95

95

 

 

 

 

 

 

 

108

108

108

 

 

96

96

96

 

97

-

97

 

 

 

 

 

 

 

110

110

110

 

 

98

98

98

 

99

-

99

 

 

 

 

 

 

 

112

112

112

 

 

100

100

100

 

101

101

101

 

 

 

 

 

 

 

114

114

114

 

 

102

102

102

 

103

103

103

 

 

 

 

 

 

 

116

116

116

 

 

104

-

104

 

105

105

105

 

 

 

 

 

 

 

118

-

118

 

 

106

106

106

 

107

107

107

 

 

 

 

 

 

 

120

-

120

 

 

110

110

110

 

109

109

109

 

 

 

 

 

 

 

-

-

122

 

 

-

-

-

 

111

111

111

 

 

 

 

 

 

 

124

-

124

 

 

114

-

114

 

113

-

113

 

 

 

 

 

 

 

126

-

-

 

 

120

-

-

 

115

115

115

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

117

117

117

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

119

-

119

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

121

-

121

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

123

-

-

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

125

-

125

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

129

-

-

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

231

-

-

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

جدول 4- هتروزیگوسیتی کل، مشاهده شده و مورد انتظار، مقادیر آماری F و برآورد جریان ژن پرایمرهای مطالعه شده میکروساتلایت‌های هسته‌ای در درختان جمعیت، درختان مادری و نتاج جمعیت‌های مطالعه شده

پارامترها

درختان جمعیت

درختان مادری

بذرها

هتروزیگوسیتی مورد انتظار

567/0

477/0

544/0

هتروزیگوسیتی مشاهده شده

579/0

565/0

550/0

 

 

 

 

مقادیر آماری F

 

 

 

Fis*

037/0-

178/0-

019/0-

Fit**

017/0

075/0-

038/0

Fst***

055/0

087/0

058/0

 

 

 

 

جریان ژن

310/4

635/2

050/4

*: ضریب خویش‌آمیزی یا شاخص تثبیت درون جمعیتی؛ ** ضریب خویش‌آمیزی کلی؛ ***: تمایز ژنتیکی

 

 

 

شکل 1- نمودار رسته‌بندی جمعیت‌‌های مختلف مورد مطالعه براساس فاصله ژنتیکی لوکوس‌‌های میکروساتلایتی درختان جمعیت (شکل بالا)، درختان مادری منتخب (شکل میانی) و بذرها (شکل پایین) با استفاده از 2 مؤلفه اصلی


 

 

شکل 2- آلل‌‌های مشاهده شده (براساس انداره جفت باز) و فراوانی آنها در لوکوس FS1-03بذرها (شکل پایین) و درختان جمعیت (شکل بالا) گروه‌های درختان خوش‌فرم و بدفرم گرگان-600 (G-1-600 و G-2-600) و خیرودکنار-1200

(K-1-1200 و K-2-1200).

 

 

 

شکل 3 - آلل‌‌های مشاهده شده (براساس انداره جفت باز) و فراوانی آنها در لوکوس FS1-15بذرها (شکل پایین) و درختان جمعیت (شکل بالا) گروه‌های درختان خوش‌فرم و بدفرم گرگان-600 (G-1-600 و G-2-600) و خیرودکنار-1200

(K-1-1200 و K-2-1200).

 

 

 

شکل 4 - آلل‌‌های مشاهده شده (براساس انداره جفت باز) و فراوانی آنها در لوکوس FS3-04بذرها (شکل پایین) و درختان جمعیت (شکل بالا) گروه‌‌های درختان خوش‌فرم و بدفرم گرگان-600 (G-1-600 و G-2-600) و خیرودکنار-1200

(K-1-1200 و K-2-1200).

 

 

 

 

 

شکل 5- آلل‌‌های مشاهده شده (براساس انداره جفت باز) و فراوانی آنها در لوکوس FS1-11بذرها (شکل پایین) و درختان جمعیت (شکل بالا) گروه‌‌های درختان خوش‌فرم و بدفرم گرگان-600 (G-1-600 و G-2-600) و خیرودکنار-1200

(K-1-1200 و K-2-1200).

 

برای تشریح طرح تمایز بذرها و درختان بد‌فرم و خوش‌فرم راش دو جمعیت مورد نظر، تمایز ژنتیکی بین درختان مختلف براساس مقادیر فاصله ژنتیکی درختان مختلف محاسبه و نمودارهای مربوطه ترسیم گردید (شکل 6). همانگونه که در نمودارها مشاهده می‌شود اختلاف مشخصی بین گروه‌های بدفرم و خوش‌فرم درختان و بذرها وجود دارد. در هر دو نمودار، گروه‌های بدفرم درختان بذرهای هر دو جمعیت توسط دومین مؤلفه اصلی از گروه‌های خوش‌فرم جدا شده‌اند. تفاوت اصلی در این دو نمودار تفاوت در رسته‌بندی گروه‌های هر جمعیت است بطوریکه در نمودار مربوط به درختان جمعیت‌ها (شکل 6، سمت چپ) اولین مؤلفه اصلی گروه‌های خوش‌فرم و بدفرم دو جمعیت مختلف را از هم جدا کرده درحالی‌که در نمودار مربوط به بذر (شکل 6، سمت راست) چنین وضعیتی مشاهده نمی‌شود.

 

 

 

 

شکل 6- نمودار رسته‌‌بندی درختان (شکل چپ) و بذرها (شکل راست) گروه‌های خوش‌فرم و بدفرم جمعیت‌‌های گرگان-600 (G-1-600 و G-2-600) و خیرودکنار-1200 (K-1-1200 و K-2-1200) براساس فاصله ژنتیکی لوکوس‌‌های میکروساتلایتی مورد مطالعه با استفاده از 2 مؤلفه اصلی.

 


بحث

انتخاب مصنوعی در مدیریت جنگل در عملیات تنک‌‌کردن و یا انتخاب پایه‌های بذر‌گیری عینیت پیدا می‌کند. تنک‌‌کردن مهمترین عملیات جنگل‌شناسی است که توسعه جمعیت‌های جنگلی را تحت تأثیر قرار می‌دهد. تنک‌‌کردن می‌تواند با هدف تغییر سن و جوان کردن جمعیت و یا با هدف حذف پایه‌های بدفرم و بمنظور اصلاح جمعیت‌ها باشد. تنک‌‌کردن به علت کاهش اندازه جمعیت و یا ترجیح برخی ژنوتیپ‌‌ها و حذف انتخابی درختان، می‌تواند ساختار ژنتیکی جمعیت را تغییر دهد. داده‌های این پژوهش نشان دادند که نه تنها پارامترهای تنوع ژنتیکی بذرها کمتر از درختان جمعیت بود، بلکه میزان شاخص تثبیت یا ضریب خویش‌آمیزی بذرها مثبت‌تر از درختان بوده که حاکی از نقص یا کمبود هتروزیگوت‌ها می‌باشد. این نتایج موافق با مطالعات اولیه Hosius (1993) بود که به وضوح نشان داده بود که ساختار ژنتیکی جمعیت Picea abiesپس از تنک‌‌کردن انتخابی درختان تغییر می‌یابد. در چندین مطالعه براساس مارکر ژنی ایزوآنزیمی نیز مشاهده شده است که هتروزیگوسیتی بعد از تنک‌‌کردن تا حدودی افزایش می‌یابد ولی تعداد آلل‌‌ها و آلل‌‌های نادر کاهش می‌یابد (Kätzel et al., 2001). در مقابل در چندین مطالعه بر روی گونه‌های درختی متعددی، تنک‌‌کردن هیچ اثر یا اثر بارزی بر ساختارهای آللی و ژنوتیپی نگذاشته است (Hussendörfer & Konnert, 2000؛ Konnert & Bauer, 2001؛ Wolf, 2001؛ Dounavi et al., 2002؛ Cremer et al., 2005). چنین نتایجی ناشی از اثر تنک‌‌کردن بر افزایش جریان ژن به‌ویژه از جمعیت‌های اطراف است. به‌طوری که در بررسی‌های بسیاری با مطالعه اثر تنک‌‌کردن انتخابی در پروسه‌های مدیریت جنگل نشان داده‌اند اگرچه تنک‌‌کردن به وسیله کم کردن تعداد پایه‌های تولیدمثل کننده بر روی ساختار ژنتیکی می‌تواند تأثیر بگذارد ولی باعث افزایش جریان گرده می‌گردد و سطح گوناگونی ژنتیکی را متعادل می‌کند (Oddou-Muratorio et al., 2004؛ Sork et al., 2005؛ Palstra & Ruzzante, 2008؛ Jacquemyn et al., 2008). در این رابطه نتایج این آزمایش نیز نشان داد تعداد آللهای مشاهده در نمونه‌های بذرها بیش از درختان جمعیت بود. ولی نکته مهم اثر تنک‌‌کردن در کاهش تعداد آلل‌‌های نادر و تنوع ژنتیکی است. این مسئله بوسیله Rajora و همکاران (2000) در جمعیت Pinus strobousبراساس مارکرهای میکروساتلایتی بخوبی نشان داده شده است. به علت ارتباط بین حضور آلل‌‌های نادر و فنوتیپ‌‌های خاص درخت، حذف درختان با توجه به فنوتیپ باعث تغییر فراوانی آللی می‌شود. به‌طوری که Hawley و همکاران (2005) با بررسی اثر حذف انتخابی درختان نشان داد که حذف درختانی با فنوتیپ پست باعث کاهش تعداد آلل‌‌های نادر و برآوردهای توانمندی ژنتیکی شده است. به علت مزیت تکاملی بلندمدت فرم‌‌های ژنی نادر، فقدان آلل‌‌های نادر می‌تواند منجر به کاهش توانمندی جمعیت‌‌ها برای سازگاری و نیز کاهش استمرار بقاء در برابر تغییرات محیطی شود. یکی از اصول مهم بسیاری از سیستم‌‌های جنگل‌شناسی در جنگل‌‌های بالغ، برداشت انتخابی درختان با فنوتیپ‌‌های برتر است (Finkeldey & Ziehe, 2004). انتخاب درختانی با ویژگی‌‌های فنوتیپی برتر اثر مخرب بیشتری از انتخاب تصادفی بر ساختار ژنتیکی دارد (Namkoong et al., 2000).

داده‌های این پژوهش به وضوح نشان می‌دهد که انتخاب مصنوعی می‌تواند ساختار ژنتیکی جمعیت‌ها را تغییر دهد. حذف انتخابی درختان و ژن‌‌هایشان از سیستم‌‌های جنگلی در طی فرایند تنک‌‌کردن، بوسیله تغییر ساختار ژنتیکی و سطح تنوع ژنتیکی روی حاصلخیزی، پایداری اکوسیستم، استمرار طویل مدت و تکامل جمعیت‌‌ها تأثیر می‌گذارد. تغییر ساختار ژنتیکی در نتیجه حذف انتخابی ژن‌‌های خاص، تغییر فراوانی ژن‌‌ها یا بهم‌ریختن سیستم‌‌های تولیدمثلی درون جمعیت‌‌ها، ساختار ژنتیکی جمعیت‌‌هاست (Hawley et al., 2005). بنابراین انتخاب تعداد محدود درخت برای بذرگیری یا برای تجدید حیات در آینده می‌تواند در دراز‌مدت منجر به فرسایش ژنتیکی جمعیت‌ها شود. ولی برداشت تک درخت یا برداشت جزئی پایه‌ها که در سیستم‌‌های مدیریت جنگل‌شناسی نزدیک به طبیعت اجرا می‌شود تأثیری بر روی ساختار ژنتیکی جمعیت‌ها ندارد (Cremer et al., 2005).

 

سپاسگزاری

پژوهش حاضر توسط مساعدت‌های مالی انستیتو بین المللی منابع ژنتیک گیاهی (Bioversity International) به کد پروژه D06C Fellowships و انستیتو ژنتیک گیاهی فلورنس ایتالیا ممکن گردیده است که به این وسیله مراتب قدردانی خود را اعلام می‌دارم.

 

منابع مورد استفاده

- رسانه، ی.، مشتاق، م. و صالحی، پ.، 1380. بررسی کمی و کیفی جنگل‌‌های شمال کشور. مجموعه مقالات همایش ملی مدیریت جنگل‌‌های شمال و توسعه پایدار، صفحات 55-79.

-  Adams,W.T., Zuo, J., Shimizu, J.Y. and Tappeiner, J.C., 1998. Impact of alternative regeneration methods on genetic diversity in coastal Douglas-fir. Forest Science, 44: 390–396.

-  Booy, G., Hendriks, R.J.J., Smulders, M.J.M., Van Groenendael, J.M. and Vosman, B., 2000. Genetic diversity and the survival of populations. Plant Biology, 2: 379–395.

-  Boyle, T., 2000. Criteria and indicators for the conservation of genetic diversity. In: Young, A.C., Boshier, D. and Boyle, T. (Eds.). Forest Conservation Genetics: Principles and Practice. CAB International, New York, USA.

-  Buiteveld, J., Vendramin, G.G., Leonardi, S., Kamer, K. and Geburek, T., 2007. Genetic diversity and differentiation in European beech (Fagus sylvatica L.) stands varying in management history. Forest Ecology and Management, 247: 98-106.

-  Cremer, E., Rumpf, H., Wolf, H., Maurer, W. and Steiner, W., 2005. Führen  Durchforstungen zu Veränderunger der genetischen Strukturen von Buchenbeständen. Forst Holz, 60: 184–188.

-  Dounavi, K.D., Steiner, W. and Maurer, W.D., 2002. Effects of different silvicultural treatments on the genetic structure of European beech populations (Fagus sylvatica L.). In: von Gadow, K., Nagel, J. and Saborowski, J. (Eds.). Continuous Cover Forestry: Assessment, Analysis, Scenarios. Kluwer Academic Publishers, Dordrecht, Boston, New York, pp. 81–90.

-  El-Kassaby, Y.A. and Benowicz, A., 2000. Effects of commercial thinning on genetic, plant species and structural diversity in second-growth Douglas-fir (Pseudotsuga menziesii (Mirb) Franco) stands. Forest Genetics, 7: 193–203.

-  El-Kassaby, Y.A., Dunsworth, B.G. and Krakowski, J., 2003. Genetic evaluation of alternative silvicultural systems in coastal montane forests: western hemlock and amabilis fir. Theoretical Applied Genetics, 107: 598–610.

-  Finkeldey, R. and Ziehe, M., 2004. Genetic implications of silvicultural regimes. Forest Ecology and Management, 197: 231–244.

-  Gilles, A.C.M., Navarro, C., Lowe, A.J., Newton, A.C., Herna´ndez, M.,Wilson, J. and Cornelius, J.P., 1999. Genetic diversity in Mesoamerican populations of mahogany (Swietenia macrophylla), assessed using RAPDs. Heredity, 83: 722–732.

-  Glaubitz, J.C., Murrell, J.C. and Moran, G.F., 2003a. Effects of native forest regeneration practices on genetic diversity in Eucalyptus consideniana. Theoretical Applied Genetics, 107: 422–431.

-  Glaubitz, J.C., Wu, H.X. and Moran, G.F., 2003b. Impacts of silviculture on genetic diversity in the native forest species Eucalyptus sieberi. Conservation Genetics, 4: 275–287.

-  Gower, J.C., 1966. Some distance properties of latent root and vector methods used in multivariate analysis. Biometrika, 53: 325-338.

-  Hawley, G.J., Schaberg, P.G., Dehayes, D.H. and Brissette, J.C., 2005. Silviculture alters the genetic structure of an eastern hemlock forest in Maine, USA. Canadian Journal of Forest Research, 35: 143-150

-  Hamrick, J.L., Godt, M.J.W. and Sherman-Broylers, S.L., 1992. Factors influencing levels of genetic diversity in woody plant species. New Forestry,  6: 95-124.

-  Hosius, B., 1993. Wird die genetische Struktur eines Fichtenbestandes von Durchforstungseingriffen beeinflußt? Forst und Holz, 48: 306–308.

-  Hussendörfer, E. and Konnert, M., 2000. Untersuchungen zur Bewirtschaftung von Weisstannen- und Buchenbeständen unter dem Aspekt der Erhaltung genetischer Variation. Forest Snow and Landscape Research, 75: 187–204.

-  Jacquemyn, H., Brys, R., Adriaens, D., Honnay, O. and Roldán-Ruiz, I. 2008. Effects of population size and forest management on genetic diversity and structure of the tuberous orchid Orchis mascula. Conservation Genetics,

-  Kätzel, R., Nordt, B. and Schmitt, J., 2001. Untersuchungen zum Einfluß der Durchforstungsintensitaät auf die genetische Struktur von Kiefernbeständen in den Berliner Forsten auf der Grundlage von Isoenzym- und DNA-Markern. In: Wolf, H., (Ed.). Nachhaltige Nutzung forstgenetischer Ressourcen. Tagungsbericht zur 24. Internationalen Tagung der Arbeitsgem. f. Forstgenetik u. Forstpflanzenzüchtung. Sächsische Landesanstalt für Forsten, Pirna, Germany, pp. 159–170.

-  Konnert, M. and Ruetz, W., 2003. Influence of nursery practices on the genetic structure of beech (Fagus sylvatica L.) seedling populations. Forest Ecology and Management, 184(1-3): 193-200.

-  Lee, C., Wickneswari, R., Mahani, M.C. and Zakri, A.H., 2002. Effect of selective logging on the genetic diversity of Scaphium macropodum. Biological Conservation, 104: 107–118.

-  MacDonald, S.E., Thomas, B.R., Cherniawsky, D.M. and Purdy, B.G., 2001. Managing genetic resources of Lodgepole pine in West-Central Alberta: patterns of isozym variation in natural populations and effects of forest management. Forest Ecology and Management, 152: 45–58.

-  Namkoong, G., Koshy, M.P. and Aitken, S., 2000. Selection. In: Young, A., Boshier, D. and Boyle, T., (Eds.). Forest Conservation Genetics: Principles and Practice. CSIRO and CABI, Collingwood, pp. 101–111.

-  Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89: 583-590.

-  Ningre, F., 1997. Une définition raisonnée de la fourche du hêtre. Revue Forestière Française, 59: 32−40.

-  Oddou-Muratorio, S., Demesure,Usch, B, Pélissier, R. and Gouyon P.H., 2004. Impacts of gene flow and logging history on the local genetic structure of a scattered tree species, Sorbus torminalis L. Crantz. Molecular Ecology, 13: 3689–3702.

Palstra F.P. and Ruzzante D.E., 2008. Genetic estimates of contemporary effective population size: what can they tell us about the importance of genetic stochasticity for wild population persistence? Molecular Ecology, 17(15): 3428-47.

-  Pastorelli R., Smulders M.J.M., Van’t Westende W.P.C., Vosman B., Giannini R., Vettori C. and Vendramin G.G., 2003. Characterization of microsatellite markers in Fagus sylvatica L. and Fagus orientalis Lipsky. Molecular Ecology Notes, 3: 76–78.

-  Pastorelli, R., Smulders, M.J.M., Westende, W.P.C., Vosman, B. and Giannini, R., 2003. Characterization of microsatellite markers in Fagua sylvatica L. and Fagus orientalis Lipsky. Molecular Ecology Notes, 3: 76-78.

-  Peakal, R. and Smouse, P.E., 2006. GenAlEx 6: genetic analysis in Excel Population genetic software for teaching and research. Molecular Ecology Notes, 6: 288–295

-  Rajora, O.P., 1999. Genetic biodiversity impacts of silvicultural practices and phenotypic selection in white spruce. Theoretical Applied Genetics, 99: 954–961.

-  Rajora, O.P., Rahnam, M.H., Buchert, G.P., and Dancik, B.P., 2000. Microsatellite DNA analysis of genetic effects of harvesting in old-growth eastern white pine (Pinus strobus) in Ontario. Canadian Molecular Ecology, 9: 330–348.

-  Raymond, M. and Rousset, F., 1995. GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. Journal of  Heredity, 86: 248-249.

-  Salehi Shanjani, P., Paule, L., Khavari-Nejad, R.A., Gömöry, D. and Sagheb-Talebi, K., 2002. Allozymic variability in beech (Fagus orientalis Lipsky) forests over Hyrcanian zone. Journal of Forest Genetics, 9: 297-297.

-  Salehi Shanjani, P., Vettori, C., Giannini, R. and Khavari-nejad, R.A., 2004. Intraspecific variation and geographic patterns of Fagus orientalis Lipsky chloroplast DNA. Silveae Genetica, 53: 193-197.

-  Salehi Shanjani, P. and Vendramin, G.G., 2005. Analysis of genetic diversity of Oriental beech (Fagus orientalis Lipsky) populations as the basis for development of gene conservation strategy in Hyrcanian forests, Iran. The 22th IUFRO World Congress, Brisbane.

-  Salehi Shanjani, P., Vendramin, G.G. and Calagari, M., 2008. Assessment of genetic structure within and among Iranian populations of beech (Fagus orientalis Lipsky): Implications for in situ gene conservation. The 8th IUFRO International Beech Symposium, Japon.

-  Sork, V.L., Smouse, P.E., Apsit, V.J., Dyer, R.J. and Westfall, R.D. 2005. A two-generation analysis of pollen pool genetic structure in flowering dogwood, Cornus florida (Cornaceae), in the Missouri Ozarks. American Journal of Botany, 92: 262-271.

-  Wolf, H., 2001. Auswirkungen von waldbaulichen Eingriffen auf die genetische Struktur von Durchforstungsbeständen der Fichte, Rotbuche und Stieleiche in Sachsen. In: Wolf, H., (Ed.). Nachhaltige Nutzung forstgenetischer Ressourcen. Tagungsbericht zur 24. Internationalen Tagung der Arbeitsgem. f. Forstgenetik u. Forstpflanzenzüchtung. Sächsische Landesanstalt für Forsten, Pirna, Germany, pp. 171–181.

 

Effects of artificial selection on genetic structure of beech

(Fagus orientalis Lipsky) populations

 

P. Salehi Shanjani1*, G.G. Vendramin2 and M. Calagari3

 

1*- Corresponding author, Asist. Prof., Research Institute of Forests and Rangelands, Tehran, I.R. Iran. E-mail: psalehi@rifr-ac.ir

2- Prof., Institute of Plant Genetic, CNR, Via Madonna del Piano, I-50019 Sesto Fiorentino, Firenze, Italy

3- Asist. Prof., Research Institute of Forests and Rangelands, Tehran, I.R. Iran

 

Received: 29.05.2009       Accepted: 14.06.2010

 

Abstract

The impact of artificial selection as the critical practice in forest management, thinning and selection of seed trees, on genetic structure was examined in oriental beech (Fagus orientalis Lipsky). In ten beech (Fagus orientalis Lipsky) populations along Hyrcanian forests, genotype of trees compared with 10 selected mother trees and their seeds (each 7 seeds) as next generation, based on four highly polymorphic microsatellite loci. In two populations forked and monopodial trees and their seeds were also investigated to study phenotypically based tree selection in forest management. Significant differences were found for allelic richness (Na), effective number of alleles (Ne), number of rare alleles, either for observed (Ho) or expected heterozygosity (He) between trees and seed samples in each population. Because of an association between the occurrence of rare alleles and tree phenotypes, phenotypically based tree removals were associated with a shift in allelic frequency and number of rare alleles, which followed by decreasing future genetic potential. Because of the theoretical long-term evolutionary benefit of unique gene forms, the loss of rare alleles could diminish the potential of populations to adapt to and survive ongoing environmental change. The results indicated that intense selection or thinning might severely affect genetic structure of beech population in long term, confirming efficiency of sustainable stand management policies with emphasis on the close to nature silviculture system and the employment of un-even aged form methods. As beech populations seem not to be affected by single or partial thinning activities, the selection system (both, the single and the group selection system) is a suitable silvicultural system for the Caspian beech forests.

 

Key words: Fagus orientalis Lipsky, artificial selection, microsatellites, genetic differentiation.

 

 

 



  • ·  اعداد کنار هر جمعیت نشان‌دهنده ارتفاع محل از سطح دریاست.